LibroSinTinta IN

Descargar Nerds en XLS

Nerds XLS

1540 Libros XLS de Nerds

  1. Feuil1 A B C D E F 1 2 3 Table S5 List of primers 4 5 6 Locus Primer ...

    [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
    Feuil1 A B C D E F 1 2 3 Table S5 List of primers 4 5 6 Locus Primer .... 36, At2g16485, TL1141, ctgcaggagcgagaaaaagggatcag, Prom NERD cloning. 37 , At2g16485, TL1122, ggatccacaaagacagtcaaagggacagg, NERD PHD cloning.
    Fuente: www.cell.com
  2. [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
  3. Sheet1 A B C D 1 TP Number Product Name Product Identification ...

    [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
    Sheet1 A B C D 1 TP Number Product Name Product Identification .... 18, TP2363177, The Slushy Man Eliquids Jolly Nerd 3mg 30ml, nerd2, Active ... 51, TP99MVW2B, The Slushy Man Eliquids Juicy Nerds 0mg 100ml, juicynerds1  ...
    Fuente: cdn.shopify.com
  4. feuille1 A B C D E F G H I J K L M N O 1 Table S4: Lists of genomic ...

    [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
    feuille1 A B C D E F G H I J K L M N O 1 Table S4: Lists of genomic .... 3, Regions_HYPOmethylated_in_nerd-1, start_TAIR10, stop_TAIR10, nerd/WT value (log2), WT/nerd fold change, Regions_Upregulated_in_nerd-1 ...
    Fuente: www.cell.com
  5. BuildingPermitIssuedCustomerDat A B C D E F G H I J K L M N O P ...

    [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
    BuildingPermitIssuedCustomerDat A B C D E F G H I J K L M N O P .... ... AZ 85120, HAMAKERS DESERT CACTUS, 10, APACHE JUNCTION, AZ, 85120, ACUFF LORENZO M, NERD POWER LLC, 6027150407, NICOLE.
    Fuente: www.maricopa.gov
  6. Sheet2 Sheet2 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z ...

    [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
    Sheet2 Sheet2 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z ....
    Fuente: rvnerds.com
  7. Untitled Spreadsheet

    [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
    Untitled Spreadsheet. 17, 687C, Nerd Herd C, CALIFORNIA ACADEMY OF MATHEMATICS AND SCIENCE, Carson, CA, United States. 18, 920A, SLO - Botics, San Luis Obispo High ...
    Fuente: www.robotevents.com
  8. aair-11-779-s002 A B C D E 1 Supplementary Table S2. DNA ...

    [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
    aair-11-779-s002 A B C D E 1 Supplementary Table S2. DNA .... AIA, aspirin-induced asthma; ATA, aspirin-tolerant asthma; NERD, nonsteroidal anti-inflammatory drug (NSAID)-exacerbated respiratory disease.
    Fuente: e-aair.org
  9. Untitled Spreadsheet

    [XLS]
    Tipo de Archivo: XLS/Microsoft Excel
    Untitled Spreadsheet. 3, 621B, Nerds of the Paradux, Marion Country STEM 4 H Club, Indianapolis, IN, United States. 4, 6842K, Kobayashi Maru, PARK TUDOR SCHOOL ...
    Fuente: www.robotevents.com

Libro Nerds en otros formatos:


Subir