LibroSinTinta IN

Descargar Sj en XLSX

Sj XLSX

51500 Libros XLSX de Sj

  1. A A B C D E F G H 1 Batches and sequencing lanes of all 1228 ...

    [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
    A A B C D E F G H 1 Batches and sequencing lanes of all 1228 .... 3, JS-sc-1, SJ-55, SJ-188, SJ-213, SJ-135, SJ-158, SJ-244, SJ-262. 4, JS-sc-2, SJ-56, SJ-189, SJ-214, SJ-136, SJ-159, SJ-245, SJ-263.
    Fuente: science.sciencemag.org
  2. [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
  3. Sheet1 A B C 1 Sequence, 5' to 3' Description Vendor 2 ...

    [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
    Sheet1 A B C 1 Sequence, 5' to 3' Description Vendor 2 .... 11, cgcggatccTAGGGTACATCAAAAGGAAA, Sj cmp7 5'UTR kanR knockout rev, IDT ... 23, TCGGTGAACTCGAATAGTAA, Sj lem2 knockout genotyping ORF rev, IDT.
    Fuente: www.cell.com
  4. AFK_asof_20210408 A B C D E F G H 1 All Fund Holdings 4/8/2021 ...

    [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
    AFK_asof_20210408 A B C D E F G H 1 All Fund Holdings 4/8/2021 .... 8 abr. 2021 ... 3, 1, NPN SJ, Naspers Ltd, BBG000CTYB91, 18,895, Stock, $4,596,303.33, 8.31%. 4, 2, SAFCOM KN, Safaricom Plc, BBG000RLQYC7, 10,438,300 ...
    Fuente: www.vaneck.com
  5. Sheet1 A B C D E F G 1 Supp. Table 2: splice junction annotation for ...

    [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
    Sheet1 A B C D E F G 1 Supp. Table 2: splice junction annotation for .... 8 ago. 2019 ... 4, SJ:new:GT/AG:103499-103773:+ +, 49, 80, 103499, 103773, 275. 5, SJ:new:CT/AC:119002-119094:- -, 2245, 3282, 119002, 119094, 93.
    Fuente: www.biorxiv.org
  6. Well Inventory thru June 2016

    [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
    Well Inventory thru June 2016. 2, AR-0001, 226179, 4076700, 5496, SJ-00186 ... 10, AR-0009, 226908, 4076480, 5524, SJ-02265, x, x ... 20, AR-0019, 231810, 4078110, 5647, SJ-03718 ...
    Fuente: geoinfo.nmt.edu
  7. Sheet1 A B C D E F G 1 Supp. Table 1: splice junction annotation for ...

    [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
    Sheet1 A B C D E F G 1 Supp. Table 1: splice junction annotation for .... 8 ago. 2019 ... 5, SJ:ncbi:CT/AC:130097-135480:- -, 23, 24, 130097, 135480, 5384. 6, SJ:new:GT/AG:75032-93517:+ +, 21, 38, 75032, 93517, 18486.
    Fuente: www.biorxiv.org
  8. Query1 A B C D E F G H I J K L M N O P Q 1 Point ID UTM Z13 ...

    [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
    Query1 A B C D E F G H I J K L M N O P Q 1 Point ID UTM Z13 .... 2, AR-0001, 226179, 4076700, 5495.87, LiDar, Groundwater well, x, x, SJ-00186, 31, 11, 31, 05/04/1977, 4, 5491.87, NMBGMR.
    Fuente: geoinfo.nmt.edu
  9. Table of Contents - Table 1 A B C D E F 1 2 Table of Contents Sheet ...

    [XLSX]
    Tipo de Archivo: XLSX/Microsoft Excel
    Table of Contents - Table 1 A B C D E F 1 2 Table of Contents Sheet .... 4, 10 team score sheet for Horse Trials (D-SJ-XC), Horse Trials ... factor of 1 and a score of 1000 in Dressage, SJ Jump and XC Jump for a total of 3000.
    Fuente: useventing.com

Libro Sj en otros formatos:


Subir